Pseudoazurin (PAz) is a blue copper protein that functions as an electron carrier in numerous microorganisms. In several denitrifying bacteria PAz serves as the electron donor to nitrite reductase (NiR) in the anaerobic respiration system. Achromobacter cycloclastes IAM 1013 was grown at 30ºC in LB medium and genomic DNA was isolated (using the GENOME kit from BIOgene). The genomic DNA was used as a template in polymerase chain reactions (PCR) in which the PAz gene was amplified using the following two primers: ccatggtgaatgcaatcaagag (forward primer) and ccatggctagaagtcgcttagt (reverse primer). The primer sequences were based on the DNA sequence of Achromobacter cycloclastes IAM 1013 PAz and were designed in such a way to include the signal sequence for the protein. The amplified fragment was cloned into PET 15b vector which digested with Nco1.Polyacrylamide gel electrophoresis was used to characterize the extracted protein
Key words: Cloning, Expression, Pseudoazurin, Gene; Protein
|
